Review





Similar Products

90
Institut Curie short tandem repeat (str) dna sequencing
Short Tandem Repeat (Str) Dna Sequencing, supplied by Institut Curie, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/str+dna+sequencing/short+tandem+repeat++str++dna+sequencing/pm33431297-77-11-19
Average 90 stars, based on 1 article reviews
short tandem repeat (str) dna sequencing - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
IDEXX str dna sequencing
Str Dna Sequencing, supplied by IDEXX, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/str+dna+sequencing/str+dna+sequencing/pmc06101268-12-2-11
Average 90 stars, based on 1 article reviews
str dna sequencing - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Sangon Biotech str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer)
Str Binding Single Stranded Dna (Str1 Aptamer Sequence: 50 Tagggaattcgtcgacggatccggggtctggtgttctgctttg Ttctgtcgggtcgtctgcaggtcgacgcatgcgccg 30, 79 Mer), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/str+dna+sequencing/str+binding+single+stranded+dna++str1+aptamer+sequence++50++tagggaattcgtcgacggatccggggtctggtgttctgctttg+ttctgtcgggtcgtctgcaggtcgacgcatgcgccg+30++79+mer+/10__1039_slash_c7ra06434a-42-0-14
Average 90 stars, based on 1 article reviews
str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results